Supplementary Materials and Methods


Download Supplementary Materials and Methods


Preview text

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

Supplementary Materials and Methods Cell culture
Human HCC cell line Hep3B was obtained from American Type Culture Collection (ATCC), MHCC97H was reserved in Liver Cancer Institute, Zhongshan Hospital (Fudan university, Shanghai, China) and mouse HCC cell line Hepa1-6 was obtained from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China). All HCC cells were cultured in Dulbecco’s modified Eagle’s medium replenished with 10% FBS (Gibco, Grand Island, NY, USA) at 37 °C in a humidified 5% CO2 incubator.
Cell viability assay and cellular apoptosis detection For the cell viability assay, 5 × 103 cells were seeded per well in 96-well plates and
CCK-8 assay was performed at indicated times. Transfected MHCC97H, Hep3B and Hepa1-6 cells were collected and stained with PI and Annexin V (BD Pharmingen, San Diego, CA, USA), then applied to flow cytometry (BD Biosciences, San Jose, CA, USA) for apoptosis detection.
Lentivirus, plasmids construction, small interfering RNA (siRNA) synthesis and transfections
Lentiviral particles with CBS shRNA or overexpression sequences were utilized to construct CBS stable knockdown Hep3B cells and CBS stable overexpression MHCC97H cells. Hep3B and MHCC97H cells were infected with corresponding lentiviral particles and then clones were selected with puromycin (2 μg/mL). The
1
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

shRNAs specifically targeting CBS were: shCBS#1 (GGTCAGAATCAACAAGATTGG), shCBS#3 (GCGTTCACCTTTGCCCGCATG). The plasmids encoding JUN, JUNB, NKX2-5, PRRX2 and mouse Cbs were constructed into the pcDNA3.13×Flag-C vector. All constructs were verified by sequencing. The siRNA specifically targeting PRRX2: CCCUGAGUCCAGAUUAUCUTT and scrambled control siRNA were synthesized by GenePharma (Shanghai, China). Cells were transfected with the plasmids or siRNAs using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions.
Tumor models Tumor xenografts in nude mice: male BALB/c nude mice weighed 18–20 g and aged
4–6 weeks were purchased from the Shanghai Model Organisms Center, Inc. (Shanghai, China). 36 mice were randomly divided into 6 groups: NC group, CBS OE group, NC+SAM (Sigma-Aldrich, St. Louis, MO, USA) group and shNC group, shCBS group and shNC +AOAA (MedChem Express, Monmouth Junction, NJ, USA) group. To construct a subcutaneous tumor model in nude mice, 1 × 107 CBS-overexpressing MHCC97H cells, CBS knockdown Hep3B cells or control cells were resuspended in 0.1 mL PBS and injected into the left flank of the mouse. 3 days later, mice from the AOAA group, SAM group and control group received intraperitoneal injections with AOAA (30 mg/kg), SAM (50 mg/kg) and corresponding vehicles once every other day, respectively. Subcutaneous tumors were monitored weekly, 4 weeks later, MHCC97Hxenografted tumors were harvested and 5 weeks later, Hep3B-xenografted tumors were
2
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

harvested for further investigation. The length and width of each tumor were measured with a vernier caliper, and tumor volume (V) was calculated according to the formula V = 1/2(length × width2). For Stattic (Sigma-Aldrich, St. Louis, MO, USA) treatment, 24 male BALB/c nude mice weighed 18–20 g and aged 4–6 weeks were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). To construct a subcutaneous tumor model in nude mice, 1 × 107 CBS knockdown Hep3B cells or control cells were resuspended in 0.1 mL PBS and injected into the left flank of each mouse. 10 days later, mice from the control group, CBS knockdown group, Stattic group and CBS knockdown plus Stattic group received intraperitoneal injection of vehicle or Stattic (5 mg/kg) once every other day. Subcutaneous tumors were harvested 5 weeks later for further investigation.
Tumor homografts in mice: For GYY4137 (Abcam, Cambridge, MA, USA) or SAM treatment, male C57BL/6 mice, and non-obese diabetic (NOD) severe combined immunodeficiency (SCID) mice weighed 20-22 g and aged 6-8 weeks were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). To construct subcutaneous tumor models, 2 × 106 Hepa1-6 cells were resuspended in 0.1 mL PBS and injected into the left flank of each mouse. 1 weeks later, mice from the GYY4137 group, SAM group and control group received intraperitoneal injections with GYY4137 (50 mg/kg), SAM (50 mg/kg) and corresponding vehicles once every other day. Subcutaneous tumors were harvested 3 weeks later for further investigation. The Cbs heterozygous knockout C57BL/6 mice (Cbs+/-) were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). PCR-genotyping of Cbs knockout mice was
3
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

performed using a three-primer assay in one reaction: forward: CCCTGGCATAGTCTCACAA, reverse 1: TGGCTCCACTCAAACAAAC, reverse 2: ACTAGAGCTTGCGGAACCC; the product size for Cbs-/- mice was 203bp, and the product size for Cbs+/+ mice was 355bp. Six-week-old Cbs+/- male mice and their agematched Cbs+/+ littermates were used to construct a subcutaneous tumor model, with 2 × 106 Hepa1-6 cells resuspended in 0.1 mL PBS and injected into the left flank of each mouse. 1 weeks later, mice from the Stattic group and control group received intraperitoneal injections with Stattic (5 mg/kg) or vehicle once every other day. Subcutaneous tumors were harvested 3 weeks later for further investigation.
For primary hepatocarcinoma model, 20-day-old Cbs+/- male mice and their agematched Cbs+/+ littermates received a single intraperitoneal injection of diethylnitrosamine (DEN; Sigma-Aldrich, St. Louis, MO, USA) dissolved in PBS at a dose of 100 mg/kg body weight, and livers were analyzed 4 months later.
All animal care and experimental protocols were approved by the Animal Ethics Committees of Zhongshan Hospital (2019-318), Fudan university, and carried out according to the Animal Management Rules of the Ministry of Health of China.
RNA preparation and Realtime-PCR RNA preparation and Realtime-PCR were performed as previously described.1 The
specific pairs of primers for different genes were list in Table S1.
Western blotting 4
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

Western blot analysis was performed as previously described.1 The following antibodies were used for interest protein detection: STAT3 (CST, Cat#9139); p-STAT3 (Tyr705, CST, Cat#9145); β-actin (CST, Cat#3700); CBS (Abcam, Cat#ab96252); Bcl3 (Proteintech, Cat#23959-1-AP); Cleaved Caspase-3 (CST, Cat#9661S), Foxp3 (Proteintech, Cat#22228-1-AP), Tet1 (Abcam, Cat#ab272901), Tet2 (Proteintech, Cat#21207-1-AP).
Enzyme-linked immunosorbent assay (ELISA) Tumor tissue lysis were used for the determination of IL-6 by an enzyme-linked
immunosorbent assay kit according to the manufacturer’s instructions (RayBiotech, Norcross, GA, USA).2
Luciferase reporter assay Luciferase reporter assays were performed as previously described.3 In brief, Hep3B
cells were seeded in 24-well plates and transfected with CBS-WT-3’ UTR or CBSMUT-3’UTR luciferase reporters along with miR-24-3p mimics or miR-24-3p inhibitor. Forty-eight hours after transfection, the cells were harvested in lysis buffer. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions on a Lumat LB 9507 luminometer (Berthold Technologies, Germany).
Hydrogensulfide (H2S) measurement 5
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

H2S measurements was conducted as previously described.4 Clinical HCC tumors, peritumors and mouse subcutaneous tumor tissues were used for the determination of H2S contents according to the manufacturer’s instructions (Solarbio, Beijing, China).
Single-cell preparation from tumor tissue Within 2 hours after resection, subcutaneous tumor tissues were immediately
processed for single-cell preparation by using the tumor dissociation kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) according to the manufacturer’s instructions. Then cell suspensions were passed through 70-mm cell strainers. After red blood cell lysis (BD Pharmingen, San Diego, CA, USA), the cells were washed and resuspended in PBS for immune cells staining and magnetic bead sorting.
Flow cytometry Single-cell were prepared by the procedure mentioned above, cell samples which
underwent IFNγ staining were firstly incubated with cell stimulation cocktail (00-497593, eBioscience) at 37 ℃ under 5% CO2 for 4 hours and then samples which underwent Foxp3 and IFNγ staining were washed with PBS prior to incubation with Fixable Viability Dye eFluorTM 780 (65-0865-18, eBioscience) diluted 1:1000 in PBS for 30 minutes at 4 ℃. Next cell samples were washed with PBS and incubated for 30 minutes at 4 ℃ with the following cell-surface antibodies: BV510 anti-CD45 (A20, 110741, Biolegend), PE-Cy7 anti-CD3 (145-2C11, 25-0031-82, eBioscience), PerCP-Cy5.5 anti-CD8 (53-6.7, 45-0081-82, eBioscience), FITC anti-CD4 (GK1.5, 557307, BD
6
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

PharMingen), APC anti-CD25 (PC61.5, 17-0251-82, eBioscience), APC-Cy7 antiCD45 (30-F11, 557659, BD PharMingen), FITC anti-CD11b (M1/70, 557396, BD PharMingen), PE-CF594 anti-F4/80 (T45-2342, 565613, BD PharMingen) and PE-Cy7 anti-Gr1(RB6-8C5, 552985, BD PharMingen). All of the cell-surface antibodies were diluted 1:200 in FACS buffer. The cells were permeabilized using the eBioscience Intracellular Fixation and Permeabilization Buffer Set (Thermo Fisher Scientific, Waltham, MA, USA) for 30 minutes at 4℃. Then they were incubated with the following intracellular antibodies: PE anti-Foxp3 (FJK-16s, 12-5773-82, eBioscience) and PE-CF594 anti-IFNγ (XMG1.2, 562303, BD PharMingen). All of the intracellular antibodies were diluted 1:200 in the eBioscience Permeabilization Buffer (1x) (Thermo Fisher Scientific, Waltham, MA, USA). Cells were washed twice with Permeabilization Buffer and applied to flow cytometry using a Beckman Coulter CytoFLEX (Beckman, Miami, FL, USA). Analysis of flow cytometry results was performed via FlowJo software (FlowJo 11.0, Ashland, OR, USA). The flow multicolor dyeing scheme for immune cells are listed in Table S2.
Magnetic sorting and culture of CD4+ T cells, CD8+ T cells and Treg cells. Single-cell were prepared by the procedure mentioned above, then cell samples were
used to sort CD8+ T cells by CD8 (TIL) MicroBeads kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), and CD4+ T cells and Treg cells were sorted by CD4+CD25+ Regulatory T Cell Isolation Kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) following by the manufacturer’s instructions. Separated cells were
7
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

plated in 6-well plates coated with CD3 antibody (BD Pharmingen, San Diego, CA, USA) (1 μg/mL) overnight and maintained in RPMI 1640 medium supplemented with 10% FBS, 10 U/mL penicillin, 10 mg/mL streptomycin, 50 ng/mL IL-2 (BD Pharmingen, San Diego, CA, USA) and 1 μg/mL CD28 antibody (BD Pharmingen, San Diego, CA, USA).
CD8+ T cell-mediated tumor cell killing assay The T cell-mediated tumor cell killing assay was conducted as described previously.5
6 Briefly, Hepa1-6 cells were seeded into 96-well plates and 12 hours later, 1:1 rated CD8+ T cells were added to the plated tumor cells. After 3 days for coculture, suspending CD8+ T cells were discarded and adherent Hepa1-6 cells were washed with PBS twice and fixed with 4% paraformaldehyde. Then Hepa1-6 cells were stained with crystal violet solution and 10% of acetic acid were utilized to extract crystal violet from the stained cells and densitometry were quantified by a Microplate Reader (Bio-Tek Instruments, Winooski, VT, USA).
Treg cell-mediated proliferation inhibition on CD8+ T cells Treg cells and CD8+ T cells were co-seeded into 6-well plates at 1:1 ratio. After 4
days for coculture, cells were collected and stained with PerCP-Cy5.5-labelled CD8 antibody, then the number of CD8+ T cells were analyzed by flow cytometry.
5-hmC detection 8
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

CD4+ T cells sorted by magnetic beads (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) were used for the immunofluorescence staining of 5-hmC (CST, Danvers, MA, USA) according to the manufacturer’s instructions and then the fluorescence intensity was detected by flow cytometer.
Extracellular flux assays ECAR were measured by Agilent Seahorse XFe96 Extracellular Flux Analyzer, as
instructed by the Glycolysis Stress Test Kit from Agilent Technologies (CA, USA). Briefly, 2 × 104 cells were plated in Cell Culture Microplates XFe96 (Agilent Seahorse) the day before the measurement. Next oligomycin (1 μM), 2-deoxy-glucose (50 mM) and glucose (10 mM) were added to determine the ECAR values.
Tissue microarray and immunohistochemistry Tissue microarray (TMA) was conducted as previously described.7 8 In this study,
immune cells and corresponding markers were listed in Table S3. Antibody sources and staining conditions were listed in Table S4.
Evaluation of Immunohistochemical Staining Evaluation of immunohistochemical staining was conducted as previously described.
9 All the consecutive images were analyzed using a computer-automated method (Image-pro plus 6.0, Media Cybernetics, Silver Springs, MD, USA).10 The spot and captured spot (×200) with image software were presented in figure. S2A.
9
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Supplemental material

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance placed on this supplemental material which has been supplied by the author(s)

J Immunother Cancer

Table S1. The specific pairs of primers used in real-time PCR

Gene name Human ACTB Human CBS
Human IL6 Mouse Cbs Mouse Il6 Mouse Tet1 Mouse Tet2 Mouse Il10 Mouse Ifng Mouse Actb Human PRRX2 Human FOS Human HNF4G Human JUN Human JUNB Human JUND Human KLF4 Human KLF5 Human NFE2L1 Human NFIC Human NFYB Human NKX2-5 Human SP1 Human THAP1

Forward GAGCACAGAGCCTCGCCTTT GGCCAAGTGTGAGTTCTTCAA ACTCACCTCTTCAGAACGAATTG GGAAAATTGGGAACACCCCTAT ACTCACCTCTTCAGAACGAATTG TCTCCGACATTTGCCCAGAC ACCTGGCTACTGTCATTGCTCC CGGGAAGACAATAACTGCACCC CAGCAACAGCAAGGCGAAAAAGG AAATCGTGCGTGACATCAAAGA GeneCopoeia, Inc. Cat#HQP012751 GeneCopoeia, Inc. Cat#HQP054675 GeneCopoeia, Inc. Cat#HQP008914 GeneCopoeia, Inc. Cat#HQP009853 GeneCopoeia, Inc. Cat#HQP009854 GeneCopoeia, Inc. Cat#HQP062670 GeneCopoeia, Inc. Cat#HQP022519 GeneCopoeia, Inc. Cat#HQP017898 GeneCopoeia, Inc. Cat#HQP011798 GeneCopoeia, Inc. Cat#HQP067069 GeneCopoeia, Inc. Cat#HQP011825 GeneCopoeia, Inc. Cat#HQP063772 GeneCopoeia, Inc. Cat#HQP017640 GeneCopoeia, Inc. Cat#CS-HQP014097-01

Reverse ATCCTTCTGACCCATGCCCA GGCTCGATAATCGTGTCCCC CCATCTTTGGAAGGTTCAGGTTG CCACCCGCATTGAAGAACTCA CCATCTTTGGAAGGTTCAGGTTG AACCGGAGAGCCATCTTTGG TGCAGTGACTCCTGAGAATGGC CGGTTAGCAGTATGTTGTCCAGC TTTCCGCTTCCTGAGGCTGGAT GCCATCTCCTGCTCGAAGTC

10
Zhou Y-F, et al. J Immunother Cancer 2021; 9:e003031. doi: 10.1136/jitc-2021-003031

Preparing to load PDF file. please wait...

0 of 0
100%
Supplementary Materials and Methods